Peanut Marker Database

AHS1741 Information

Marker name AHS1741
Marker category EST-SSR
Primer sequences Fw CGCAATTACTGCCACCATTA
Rv TTGCTTCAGCAAAGTCAACG
EST/Genome sequences AHCS22H10
Lines
PIC Value
Lines
Map TF6 Linkage TA04
Position 32.117
TF6 Linkage TB04
Position 50.659
Integrated consensus map Linkage B04
Position 39.43
Integrated consensus map Linkage A04
Position 28.008
SNP Position
Method
SSR Fragment size 198
Pattern* GGT(mis1)
Repeat count 7
Method PCR
Detection
Multiplex
Gel image AHS1726_1750.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea