Peanut Marker Database

AHS1689 Information

Marker name AHS1689
Marker category EST-SSR
Primer sequences Fw GTTGCTGAAGTGCAAATCCA
Rv GAAGACAGCCTGTGGAAAGC
EST/Genome sequences AHCS22D18
Lines
PIC Value
Lines
Map AF5 Linkage AA05
Position 54.909
BF6 Linkage BB06
Position 13.746
Integrated consensus map Linkage B06
Position 82.686
Integrated consensus map Linkage A05
Position 49.587
SNP Position
Method
SSR Fragment size 109
Pattern* AAG
Repeat count 10
Method PCR
Detection
Multiplex
Gel image AHS1676_1700.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea