Peanut Marker Database

AHS1620 Information

Marker name AHS1620
Marker category EST-SSR
Primer sequences Fw CCTCAACAACCACCCTCACT
Rv TACACACCATCCTCTGCCAA
EST/Genome sequences AHCG16B01
Lines
PIC Value
Lines
Map AF5 Linkage AA09
Position 12.472
BF6 Linkage BB09
Position 16.54
Integrated consensus map Linkage B09
Position 70.947
Integrated consensus map Linkage A09
Position 82.347
SNP Position
Method
SSR Fragment size 207
Pattern* AAG(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image AHS1601_1625.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea