Peanut Marker Database

AHS1554 Information

Marker name AHS1554
Marker category EST-SSR
Primer sequences Fw CCGAGAAGTTGATGAGGAGC
Rv GTGGCTTTGATGGATGGTTT
EST/Genome sequences AHCG10F07
Lines
PIC Value
Lines
Map AF5 Linkage AA01
Position 14.269
AF5 Linkage AA04
Position 40.039
Integrated consensus map Linkage A04
Position 48.78
Integrated consensus map Linkage A01
Position 71.384
SNP Position
Method
SSR Fragment size 231
Pattern* AAC(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image AHS1551_1575.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea