Peanut Marker Database

AHS1510 Information

Marker name AHS1510
Marker category EST-SSR
Primer sequences Fw AAAAGCACTTCACCCCCTTT
Rv GAGCTGAACCTGCTTTCCAG
EST/Genome sequences AHCG07E10
Lines
PIC Value
Lines
Map AF5 Linkage AA07
Position 7.978
BF6 Linkage BB07
Position 38.798
TF6 Linkage TB06
Position 14.583
TF6 Linkage TA07
Position 31.854
Integrated consensus map Linkage A07
Position 68.25
Integrated consensus map Linkage B06
Position 80.655
Integrated consensus map Linkage B07
Position 85.27
SNP Position
Method
SSR Fragment size 299
Pattern* AAC(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image AHS1501_1525.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea