Peanut Marker Database

AHS1480 Information

Marker name AHS1480
Marker category EST-SSR
Primer sequences Fw TGGGCTCCAACAATACAACA
Rv TGTGTACAGGCATCATCGGT
EST/Genome sequences AHCG05G15
Lines
PIC Value
Lines
Map SKF2 Linkage LG07.2
Position 88.139
BF6 Linkage BB07
Position 33.958
BF6 Linkage BB07
Position 36.63
Integrated consensus map Linkage B07
Position 90.574
Integrated consensus map Linkage B07
Position 80.803
Integrated consensus map Linkage B07
Position 88.437
SNP Position
Method
SSR Fragment size 233
Pattern* AAT(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image AHS1476_1500.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea