Marker name | AHS1474 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | GAGAGAGAGAGGCACCTCCA | |
Rv | TAGATGGGTTCGCCAGAAGT | ||
EST/Genome sequences | AHCG05A19 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | AF5 | Linkage | AA06 |
Position | 36.203 | ||
AF5 | Linkage | AA09 | |
Position | 13.848 | ||
Integrated consensus map | Linkage | A06 | |
Position | 64.313 | ||
Integrated consensus map | Linkage | A09 | |
Position | 80.531 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 300 | |
Pattern* | AAT(mis2) | ||
Repeat count | 5 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image |
AHS1451_1475.ppt [download] |
||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.