Peanut Marker Database

AHS1351 Information

Marker name AHS1351
Marker category EST-SSR
Primer sequences Fw AAAACCCTCCAAAACCAACC
Rv AGCCATAATCGCACCAATTC
EST/Genome sequences AHCS14A02
Lines
PIC Value
Lines
Map AF5 Linkage AA05
Position 51.186
AF5 Linkage AA02
Position 22.825
AF5 Linkage AA04
Position 37.664
BF6 Linkage BB03
Position 6.593
TF6 Linkage TA02
Position 49.366
Integrated consensus map Linkage B03
Position 31.979
Integrated consensus map Linkage A02
Position 41.821
Integrated consensus map Linkage A04
Position 47.26
Integrated consensus map Linkage A05
Position 54.944
SNP Position
Method
SSR Fragment size 128
Pattern* AAG(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image AHS1351_1375.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea