Peanut Marker Database

AHS1169 Information

Marker name AHS1169
Marker category EST-SSR
Primer sequences Fw GTCTTGTCATCGCCGAACTC
Rv TGCATCTGAAGAACATCAACCT
EST/Genome sequences AHCS05F16
Lines
PIC Value
Lines
Map TF6 Linkage TA03
Position 52.574
TF6 Linkage TA05
Position 30.811
Integrated consensus map Linkage A05
Position 56.196
Integrated consensus map Linkage A03
Position 89.742
SNP Position
Method
SSR Fragment size 279
Pattern* AAC(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image AHS1151_1175.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea