Peanut Marker Database

AHS1117 Information

Marker name AHS1117
Marker category EST-SSR
Primer sequences Fw TCTGGTGGCGGTGGAGTT
Rv AAATGGCAAAACCCATGAAA
EST/Genome sequences AHCS03I16
Lines
PIC Value
Lines
Map AF5 Linkage AA01
Position 14.402
BF6 Linkage BB02
Position 12.615
Integrated consensus map Linkage B02
Position 63.176
Integrated consensus map Linkage A01
Position 70.91
SNP Position
Method
SSR Fragment size 267
Pattern* AGC(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image AHS1101_1125.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea