Peanut Marker Database

AHS1022 Information

Marker name AHS1022
Marker category EST-SSR
Primer sequences Fw CTGGCATGCTCTGTCTATCG
Rv TGGTTCTGTGTAGGAAGGGG
EST/Genome sequences AHCG09L19
Lines
PIC Value
Lines
Map BF6 Linkage BB06
Position 17.741
BF6 Linkage BB09
Position 13.362
BF6 Linkage BB09
Position 14.853
TF6 Linkage TA09
Position 34.845
Integrated consensus map Linkage A09
Position 80.671
Integrated consensus map Linkage B06
Position 85.876
Integrated consensus map Linkage B09
Position 72.17
Integrated consensus map Linkage B09
Position 73.858
SNP Position
Method
SSR Fragment size 201
Pattern* AAAG(mis2)
Repeat count 4
Method PCR
Detection
Multiplex
Gel image AHS1001_1025.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea