| Marker name | AHS1004 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | TTCAAACTCCCCAACCAAAC | |
| Rv | ACCCTGATTGTTGCCTTGAC | ||
| EST/Genome sequences | AHCG07A02 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Map | BF6 | Linkage | BB10 |
| Position | 26.252 | ||
| TF6 | Linkage | TA02 | |
| Position | 48.337 | ||
| TF6 | Linkage | TA10 | |
| Position | 6.493 | ||
| Integrated consensus map | Linkage | A02 | |
| Position | 39.686 | ||
| Integrated consensus map | Linkage | A10 | |
| Position | 96.667 | ||
| Integrated consensus map | Linkage | B10 | |
| Position | 66.896 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 294 | |
| Pattern* | AT(mis2) | ||
| Repeat count | 8 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image |
AHS1001_1025.ppt [download] |
||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Koilkonda et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.