Peanut Marker Database

AHS1004 Information

Marker name AHS1004
Marker category EST-SSR
Primer sequences Fw TTCAAACTCCCCAACCAAAC
Rv ACCCTGATTGTTGCCTTGAC
EST/Genome sequences AHCG07A02
Lines
PIC Value
Lines
Map BF6 Linkage BB10
Position 26.252
TF6 Linkage TA10
Position 6.493
TF6 Linkage TA02
Position 48.337
Integrated consensus map Linkage A02
Position 39.686
Integrated consensus map Linkage A10
Position 96.667
Integrated consensus map Linkage B10
Position 66.896
SNP Position
Method
SSR Fragment size 294
Pattern* AT(mis2)
Repeat count 8
Method PCR
Detection
Multiplex
Gel image AHS1001_1025.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea