Marker name | AHS0946 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | TCATCCAACCATAATGTAAACAGA | |
Rv | TGATGTGTGCTAGCTGGCTT | ||
EST/Genome sequences | AHCS09I05 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | TF6 | Linkage | TB02 |
Position | 30.242 | ||
TF6 | Linkage | TA02 | |
Position | 53.394 | ||
Integrated consensus map | Linkage | A02 | |
Position | 45.8 | ||
Integrated consensus map | Linkage | B02 | |
Position | 71.57 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 243 | |
Pattern* | AAAG(mis2) | ||
Repeat count | 4 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image |
AHS0926_0950.ppt [download] |
||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.