Peanut Marker Database

AHS0941 Information

Marker name AHS0941
Marker category EST-SSR
Primer sequences Fw CATTGGAAGCAAATCAGCAA
Rv CACCCTAATTCCCCCAAGTT
EST/Genome sequences AHCS08C08
Lines
PIC Value
Lines
Map BF6 Linkage BB09
Position 42.6
TF6 Linkage TA09
Position 28.458
Integrated consensus map Linkage B09
Position 100.355
Integrated consensus map Linkage A09
Position 85.261
SNP Position
Method
SSR Fragment size 183
Pattern* AG(mis2)
Repeat count 8
Method PCR
Detection
Multiplex
Gel image AHS0926_0950.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea