Marker name | AHS0757 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | GCTAGGGTTGAAGCCGTTTT | |
Rv | GAAGAGAGGGGAAAAGAGGG | ||
EST/Genome sequences | AHCS11G02 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | AF5 | Linkage | AA01 |
Position | 21.481 | ||
AF5 | Linkage | AA09 | |
Position | 16.565 | ||
BF6 | Linkage | BB03 | |
Position | 34.687 | ||
Integrated consensus map | Linkage | A09 | |
Position | 73.95 | ||
Integrated consensus map | Linkage | B03 | |
Position | 72.652 | ||
Integrated consensus map | Linkage | A01 | |
Position | 79.401 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 111 | |
Pattern* | GGC(mis2) | ||
Repeat count | 6 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image |
AHS0751_0775.ppt [download] |
||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.