Peanut Marker Database

AHS0745 Information

Marker name AHS0745
Marker category EST-SSR
Primer sequences Fw TCATTTGCTGACACCTGCTC
Rv CCACTCACGTTTGGATCCTT
EST/Genome sequences AHCS10I14
Lines
PIC Value
Lines
Map AF5 Linkage AA05
Position 52.381
AF5 Linkage AA03
Position 32.608
Integrated consensus map Linkage A03
Position 95.836
Integrated consensus map Linkage A05
Position 54.015
SNP Position
Method
SSR Fragment size 300
Pattern* GGC(mis2)
Repeat count 6
Method PCR
Detection
Multiplex
Gel image AHS0726_0750.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea