Peanut Marker Database

AHS0739 Information

Marker name AHS0739
Marker category EST-SSR
Primer sequences Fw CATCTTCCGAATCCACCACT
Rv TCCAAAGAATATTCGGCCAG
EST/Genome sequences AHCS09H15
Lines
PIC Value
Lines
Map BF6 Linkage BB05
Position 14.879
TF6 Linkage TA05
Position 23.753
Integrated consensus map Linkage B05
Position 50.368
Integrated consensus map Linkage A05
Position 50.344
SNP Position
Method
SSR Fragment size 158
Pattern* AAG(mis2)
Repeat count 6
Method PCR
Detection
Multiplex
Gel image AHS0726_0750.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea