Marker name | AHS0646 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | ACAGCCTCGGCTAACTGAAA | |
Rv | GAACAGCTTGGGTGGAAGAA | ||
EST/Genome sequences | AHCG03F04 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | TF6 | Linkage | TA03 |
Position | 5.529 | ||
Integrated consensus map | Linkage | A03 | |
Position | 43.599 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 266 | |
Pattern* | AAG(mis2) | ||
Repeat count | 7 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image |
AHS0626_0650.ppt [download] |
||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.