Peanut Marker Database

AHS0632 Information

Marker name AHS0632
Marker category EST-SSR
Primer sequences Fw CGGCCAAGCTCAGAATCTAC
Rv CGAATACATCATCAGCGGAA
EST/Genome sequences AHCS11O14
Lines
PIC Value
Lines
Map AF5 Linkage AA05
Position 52.352
BF6 Linkage BB05
Position 15.442
Integrated consensus map Linkage B05
Position 50.639
Integrated consensus map Linkage A05
Position 54.082
SNP Position
Method
SSR Fragment size 156
Pattern* AAG(mis2)
Repeat count 7
Method PCR
Detection
Multiplex
Gel image AHS0626_0650.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea