Peanut Marker Database

AHS0626 Information

Marker name AHS0626
Marker category EST-SSR
Primer sequences Fw TTCATCACCATCACCCTCCT
Rv CCGAACTGAAACCGTTTGTT
EST/Genome sequences AHCS08L15
Lines
PIC Value
Lines
Map AF5 Linkage AA01
Position 0.0
BF6 Linkage BB02
Position 11.984
TF6 Linkage TA02
Position 52.164
Integrated consensus map Linkage B02
Position 66.197
Integrated consensus map Linkage A01
Position 56.839
Integrated consensus map Linkage A02
Position 44.501
SNP Position
Method
SSR Fragment size 229
Pattern* GGT(mis2)
Repeat count 7
Method PCR
Detection
Multiplex
Gel image AHS0626_0650.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea