Marker name | AHS0626 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | TTCATCACCATCACCCTCCT | |
Rv | CCGAACTGAAACCGTTTGTT | ||
EST/Genome sequences | AHCS08L15 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | AF5 | Linkage | AA01 |
Position | 0.0 | ||
BF6 | Linkage | BB02 | |
Position | 11.984 | ||
TF6 | Linkage | TA02 | |
Position | 52.164 | ||
Integrated consensus map | Linkage | A01 | |
Position | 56.839 | ||
Integrated consensus map | Linkage | A02 | |
Position | 44.501 | ||
Integrated consensus map | Linkage | B02 | |
Position | 66.197 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 229 | |
Pattern* | GGT(mis2) | ||
Repeat count | 7 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image |
AHS0626_0650.ppt [download] |
||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.