Peanut Marker Database

AHS0572 Information

Marker name AHS0572
Marker category EST-SSR
Primer sequences Fw AGGTGTGTGTGTTCCACAGc
Rv GAGAAGTGTTGAAGGAGCGG
EST/Genome sequences AHCS02H09
Lines
PIC Value
Lines
Map BF6 Linkage BB04
Position 21.01
TF6 Linkage TA02
Position 52.663
TF6 Linkage TA04
Position 57.459
Integrated consensus map Linkage B04
Position 63.571
Integrated consensus map Linkage A02
Position 44.691
Integrated consensus map Linkage A04
Position 51.532
SNP Position
Method
SSR Fragment size 99
Pattern* AC(mis2)
Repeat count 14
Method PCR
Detection
Multiplex
Gel image AHS0551_0575.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea