Marker name | AHS0314 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | CCACCACCTATTCGACTCGT | |
Rv | CTCTAGGCTTGGGAGCTTCA | ||
EST/Genome sequences | AHCG05L10 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | SKF2 | Linkage | LG02.1 |
Position | 51.09 | ||
NYF2 | Linkage | LG02.1 | |
Position | 17.842 | ||
TF6 | Linkage | TA02 | |
Position | 35.774 | ||
TF6 | Linkage | TB02 | |
Position | 8.336 | ||
Integrated consensus map | Linkage | A02 | |
Position | 26.842 | ||
Integrated consensus map | Linkage | B02 | |
Position | 43.882 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 241 | |
Pattern* | AAC | ||
Repeat count | 10 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image |
AHS0301_0325.ppt [download] |
||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.