Peanut Marker Database

AHS0290 Information

Marker name AHS0290
Marker category EST-SSR
Primer sequences Fw ATGCACATGGCAGATCTTTG
Rv AGAGCCTTCTGGACCTCACA
EST/Genome sequences AHCS04C17
Lines
PIC Value
Lines
Map BF6 Linkage BB04
Position 25.058
TF6 Linkage TB05
Position 61.83
Integrated consensus map Linkage B05
Position 96.707
Integrated consensus map Linkage B04
Position 66.237
SNP Position
Method
SSR Fragment size 231
Pattern* GGA(mis1)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image AHS0276_0300.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea