Peanut Marker Database

AHS0239 Information

Marker name AHS0239
Marker category EST-SSR
Primer sequences Fw CAAGCACTCAAGCAACCTCA
Rv AGCGATGCAACTGATGACAG
EST/Genome sequences AHCS03N14
Lines
PIC Value
Lines
Map BF6 Linkage BB07
Position 31.717
TF6 Linkage TA07
Position 36.566
Integrated consensus map Linkage B07
Position 86.277
Integrated consensus map Linkage A07
Position 74.522
SNP Position
Method
SSR Fragment size 245
Pattern* ATC(mis1)
Repeat count 6
Method PCR
Detection
Multiplex
Gel image AHS0226_0250.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea