Peanut Marker Database

AHS0087 Information

Marker name AHS0087
Marker category EST-SSR
Primer sequences Fw AACACAAAAAGCAGCCATCA
Rv TCCGAGGAAGATTGAAGGAG
EST/Genome sequences AHCS08L07
Lines
PIC Value
Lines
Map BF6 Linkage BB10
Position 24.837
BF6 Linkage BB04
Position 34.964
TF6 Linkage TA04
Position 64.951
Integrated consensus map Linkage A04
Position 57.551
Integrated consensus map Linkage B04
Position 77.168
Integrated consensus map Linkage B10
Position 64.794
SNP Position
Method
SSR Fragment size 251
Pattern* AAT
Repeat count 7
Method PCR
Detection
Multiplex
Gel image AHS0076_0100.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea