Peanut Marker Database

AHS0048 Information

Marker name AHS0048
Marker category EST-SSR
Primer sequences Fw CACCACCACCCACAAACCTA
Rv TGATTAAGCTGATCCACCGA
EST/Genome sequences AHCS02F12
Lines
PIC Value
Lines
Map TF6 Linkage TB03
Position 50.875
TF6 Linkage TA03
Position 23.974
Integrated consensus map Linkage A03
Position 62.783
Integrated consensus map Linkage B03
Position 43.173
SNP Position
Method
SSR Fragment size 243
Pattern* AG
Repeat count 13
Method PCR
Detection
Multiplex
Gel image AHS0026_0050.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea