Peanut Marker Database

AHGS3755 Information

Marker name AHGS3755
Marker category Genome-SSR
Primer sequences Fw GGAACATTGAACCTGAAATGAA
Rv ATCAAAAATCACTGAGGGCG
EST/Genome sequences KIAC14L08
Lines
PIC Value
Lines
Map BF6 Linkage BB07
Position 25.22
TF6 Linkage TA05
Position 23.228
Integrated consensus map Linkage B07
Position 79.598
Integrated consensus map Linkage A05
Position 50.726
SNP Position
Method
SSR Fragment size 252
Pattern* AATG(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea