Peanut Marker Database

AHGS3747 Information

Marker name AHGS3747
Marker category Genome-SSR
Primer sequences Fw GTTCTCACCCATGCGAATTT
Rv CAAGACTCAGCTCGCAAAGA
EST/Genome sequences KIAC12C15
Lines
PIC Value
Lines
Map BF6 Linkage BB09
Position 0.0
TF6 Linkage TA07
Position 19.103
Integrated consensus map Linkage B09
Position 56.923
Integrated consensus map Linkage A07
Position 93.601
SNP Position
Method
SSR Fragment size 293
Pattern* AT(mis2)
Repeat count 10
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea