Peanut Marker Database

AHGS3734 Information

Marker name AHGS3734
Marker category Genome-SSR
Primer sequences Fw TTAAGAACGGATTGGTTCGG
Rv CGGTTATGGAGGTGCAAAAT
EST/Genome sequences KIAC07E15
Lines
PIC Value
Lines
Map BF6 Linkage BB02
Position 25.8
TF6 Linkage TA03
Position 69.285
TF6 Linkage TA03
Position 101.873
TF6 Linkage TB10
Position 22.139
Integrated consensus map Linkage A03
Position 137.716
Integrated consensus map Linkage B02
Position 74.723
Integrated consensus map Linkage B10
Position 58.074
Integrated consensus map Linkage A03
Position 108.829
SNP Position
Method
SSR Fragment size 285
Pattern* AAAT(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea