Peanut Marker Database

AHGS3724 Information

Marker name AHGS3724
Marker category Genome-SSR
Primer sequences Fw TCTTGCAACTCCTTGCACC
Rv ACCAGTTCGATCATCGGTTC
EST/Genome sequences KIAC05I09
Lines
PIC Value
Lines
Map AF5 Linkage AA02
Position 13.014
BF6 Linkage BB02
Position 15.298
Integrated consensus map Linkage B02
Position 65.473
Integrated consensus map Linkage A02
Position 33.556
SNP Position
Method
SSR Fragment size 295
Pattern* AATT(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea