Peanut Marker Database

AHGS3712 Information

Marker name AHGS3712
Marker category Genome-SSR
Primer sequences Fw TTTGTGCGTGTCTGTGATGA
Rv ACGCCCACTGCTTCTACTGT
EST/Genome sequences SACT11E04
Lines
PIC Value
Lines
Map BF6 Linkage BB09
Position 17.358
TF6 Linkage TA10
Position 10.276
TF6 Linkage TB09
Position 15.752
TF6 Linkage TA06
Position 48.357
Integrated consensus map Linkage A06
Position 48.945
Integrated consensus map Linkage A10
Position 91.619
Integrated consensus map Linkage B09
Position 70.362
SNP Position
Method
SSR Fragment size 188
Pattern* GGGA(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea