Peanut Marker Database

AHGS3684 Information

Marker name AHGS3684
Marker category Genome-SSR
Primer sequences Fw TGACATAACGGCAATGGAAA
Rv TGCATTGTTTCCAAATCCAA
EST/Genome sequences SAAC11N22
Lines
PIC Value
Lines
Map SKF2 Linkage LG01.2
Position 56.841
BF6 Linkage BB03
Position 14.433
Integrated consensus map Linkage B03
Position 50.943
Integrated consensus map Linkage B01
Position 60.522
SNP Position
Method
SSR Fragment size 297
Pattern* AC(mis2)
Repeat count 10
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea