Peanut Marker Database

AHGS3678 Information

Marker name AHGS3678
Marker category Genome-SSR
Primer sequences Fw GTTGAGGGCATCTCTCTTGC
Rv GTAGGCGTGAAGGACGGATA
EST/Genome sequences SAAC08D14
Lines
PIC Value
Lines
Map SKF2 Linkage LG03.2
Position 101.652
BF6 Linkage BB03
Position 5.24
Integrated consensus map Linkage B03
Position 41.897
Integrated consensus map Linkage A03
Position 41.543
SNP Position
Method
SSR Fragment size 213
Pattern* AAAG(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea