Peanut Marker Database

AHGS3232 Information

Marker name AHGS3232
Marker category Genome-SSR
Primer sequences Fw TGTGGATGTCCATTTCCAAG
Rv TTTGGTTAGAGTCTCGTGCTGA
EST/Genome sequences KICT09L24
Lines
PIC Value
Lines
Map SKF2 Linkage LG04.1
Position 69.767
AF5 Linkage AA06
Position 34.955
AF5 Linkage AA10
Position 19.823
AF5 Linkage AA10
Position 38.186
TF6 Linkage TB04
Position 17.392
Integrated consensus map Linkage A10
Position 78.148
Integrated consensus map Linkage A10
Position 96.414
Integrated consensus map Linkage B04
Position 56.942
Integrated consensus map Linkage A06
Position 62.181
SNP Position
Method
SSR Fragment size 263
Pattern* AAAT(mis1)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea