Marker name | AHGS3227 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | CCAGAGTTGTCTGCCTGTCA | |
Rv | GGTCAAAAACAGCACATTGG | ||
EST/Genome sequences | KIAC14K09 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | TF6 | Linkage | TA03 |
Position | 85.027 | ||
TF6 | Linkage | TA03 | |
Position | 94.253 | ||
TF6 | Linkage | TA08 | |
Position | 97.705 | ||
Integrated consensus map | Linkage | A03 | |
Position | 133.604 | ||
Integrated consensus map | Linkage | A08 | |
Position | 112.907 | ||
Integrated consensus map | Linkage | A03 | |
Position | 122.195 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 218 | |
Pattern* | AAAC(mis1) | ||
Repeat count | 5 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.