Peanut Marker Database

AHGS3227 Information

Marker name AHGS3227
Marker category Genome-SSR
Primer sequences Fw CCAGAGTTGTCTGCCTGTCA
Rv GGTCAAAAACAGCACATTGG
EST/Genome sequences KIAC14K09
Lines
PIC Value
Lines
Map TF6 Linkage TA03
Position 85.027
TF6 Linkage TA03
Position 94.253
TF6 Linkage TA08
Position 97.705
Integrated consensus map Linkage A08
Position 112.907
Integrated consensus map Linkage A03
Position 122.195
Integrated consensus map Linkage A03
Position 133.604
SNP Position
Method
SSR Fragment size 218
Pattern* AAAC(mis1)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea