Peanut Marker Database

AHGS3207 Information

Marker name AHGS3207
Marker category Genome-SSR
Primer sequences Fw GAGAGAGAGTGGGAGGGTGA
Rv TGGTTGGAAACCACAACAAA
EST/Genome sequences SACT06B18
Lines
PIC Value
Lines
Map TF6 Linkage TB06
Position 17.782
TF6 Linkage TB09
Position 24.234
TF6 Linkage TA03
Position 96.704
TF6 Linkage TA07
Position 54.347
Integrated consensus map Linkage A03
Position 135.692
Integrated consensus map Linkage A07
Position 94.128
Integrated consensus map Linkage B06
Position 78.557
Integrated consensus map Linkage B09
Position 72.446
SNP Position
Method
SSR Fragment size 287
Pattern* AG(mis1)
Repeat count 10
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea