Peanut Marker Database

AHGS3182 Information

Marker name AHGS3182
Marker category Genome-SSR
Primer sequences Fw CCTCCACCACTACCACCACT
Rv CATCAATCACGCAACCATTC
EST/Genome sequences KICT08A24
Lines
PIC Value
Lines
Map BF6 Linkage BB03
Position 11.269
BF6 Linkage BB05
Position 19.302
Integrated consensus map Linkage B05
Position 52.096
Integrated consensus map Linkage B03
Position 46.843
SNP Position
Method
SSR Fragment size 224
Pattern* AG(mis1)
Repeat count 11
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea