Peanut Marker Database

AHGS3140 Information

Marker name AHGS3140
Marker category Genome-SSR
Primer sequences Fw AATTAGCCCCAGAGACGTTG
Rv AGAAGAAATCCCCGCTCTTC
EST/Genome sequences KICT09F16
Lines
PIC Value
Lines
Map SKF2 Linkage LG03.2
Position 51.118
AF5 Linkage AA04
Position 41.666
AF5 Linkage AA03
Position 24.948
Integrated consensus map Linkage A03
Position 85.384
Integrated consensus map Linkage A04
Position 47.677
SNP Position
Method
SSR Fragment size 281
Pattern* AAG
Repeat count 5
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea