Peanut Marker Database

AHGS3130 Information

Marker name AHGS3130
Marker category Genome-SSR
Primer sequences Fw CCGACCATCACTTGTAGGCT
Rv TGTTGCCATATTGGTTTTTCTC
EST/Genome sequences KIAC14P11
Lines
PIC Value
Lines
Map AF5 Linkage AA04
Position 10.062
BF6 Linkage BB03
Position 20.136
Integrated consensus map Linkage B03
Position 56.946
Integrated consensus map Linkage A04
Position 17.073
SNP Position
Method
SSR Fragment size 225
Pattern* AAC
Repeat count 5
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea