Peanut Marker Database

AHGS2820 Information

Marker name AHGS2820
Marker category Genome-SSR
Primer sequences Fw GCGTGTGTGTGTGTGTGTGT
Rv GGAACTCAACCCTATGGCAA
EST/Genome sequences SAAC12A24
Lines
PIC Value
Lines
Map NYF2 Linkage LG01.1
Position 14.734
TF6 Linkage TA10
Position 4.398
TF6 Linkage TA01
Position 44.624
Integrated consensus map Linkage A01
Position 78.846
Integrated consensus map Linkage A10
Position 89.382
SNP Position
Method
SSR Fragment size 143
Pattern* AG
Repeat count 9
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea