Peanut Marker Database

AHGS2793 Information

Marker name AHGS2793
Marker category Genome-SSR
Primer sequences Fw TTTTGGATCGAACCGTTCTC
Rv GTGTACCATGCTGATGCCAC
EST/Genome sequences KICT13M19
Lines
PIC Value
Lines
Map TF6 Linkage TA04
Position 0.0
TF6 Linkage TB04
Position 33.279
Integrated consensus map Linkage B04
Position 3.533
Integrated consensus map Linkage A04
Position 0.0
SNP Position
Method
SSR Fragment size 119
Pattern* AG
Repeat count 10
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea