Peanut Marker Database

AHGS2791 Information

Marker name AHGS2791
Marker category Genome-SSR
Primer sequences Fw AAACTCTCATCGCAGCACAG
Rv CTGCCTCACGAAATAAAGCA
EST/Genome sequences KICT12L18
Lines
PIC Value
Lines
Map NYF2 Linkage LG05.2
Position 0.0
TF6 Linkage TA05
Position 46.655
Integrated consensus map Linkage B05
Position 17.869
Integrated consensus map Linkage A05
Position 12.612
SNP Position
Method
SSR Fragment size 232
Pattern* AG
Repeat count 10
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea