Peanut Marker Database

AHGS2782 Information

Marker name AHGS2782
Marker category Genome-SSR
Primer sequences Fw ATGCGGAACTCCACAATTTC
Rv TGACGTCGAGTTCATCAAGC
EST/Genome sequences KICT08G01
Lines
PIC Value
Lines
Map SKF2 Linkage LG04.1
Position 5.258
SKF2 Linkage LG04.2
Position 90.3
BF6 Linkage BB04
Position 42.145
TF6 Linkage TA04
Position 75.558
TF6 Linkage TB04
Position 38.555
Integrated consensus map Linkage B04
Position 86.592
Integrated consensus map Linkage A04
Position 70.915
SNP Position
Method
SSR Fragment size 295
Pattern* AG
Repeat count 10
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea