Peanut Marker Database

AHGS2732 Information

Marker name AHGS2732
Marker category Genome-SSR
Primer sequences Fw ACAAAGGGTCTCCACCACTG
Rv CCTAAGCAGTCAAACGGAGG
EST/Genome sequences SACT14M23
Lines
PIC Value
Lines
Map BF6 Linkage BB02
Position 15.397
TF6 Linkage TA02
Position 52.053
Integrated consensus map Linkage B02
Position 65.923
Integrated consensus map Linkage A02
Position 44.386
SNP Position
Method
SSR Fragment size 234
Pattern* AG
Repeat count 10
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea