Peanut Marker Database

AHGS2726 Information

Marker name AHGS2726
Marker category Genome-SSR
Primer sequences Fw GCGACGTAGACGAAGGTCTC
Rv CTCGTCTTTGTCGAGCATCA
EST/Genome sequences SACT14F20
Lines
PIC Value
Lines
Map BF6 Linkage BB02
Position 5.009
TF6 Linkage TA08
Position 57.588
Integrated consensus map Linkage B02
Position 54.45
Integrated consensus map Linkage A08
Position 71.873
SNP Position
Method
SSR Fragment size 258
Pattern* AG
Repeat count 10
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea