Peanut Marker Database

AHGS2722 Information

Marker name AHGS2722
Marker category Genome-SSR
Primer sequences Fw TGGTTGTCTTGTGCTTCGTC
Rv TACACTCTCTTCCGCCACCT
EST/Genome sequences SACT12I06
Lines
PIC Value
Lines
Map BF6 Linkage BB09
Position 11.389
TF6 Linkage TA09
Position 36.157
Integrated consensus map Linkage B09
Position 76.58
Integrated consensus map Linkage A09
Position 77.98
SNP Position
Method
SSR Fragment size 118
Pattern* AG
Repeat count 10
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea