Peanut Marker Database

AHGS2715 Information

Marker name AHGS2715
Marker category Genome-SSR
Primer sequences Fw ATGAGGCTTCGATGGACAAC
Rv GCGTGGCCTAAAGGTATCAA
EST/Genome sequences SACT12B04
Lines
PIC Value
Lines
Map BF6 Linkage BB02
Position 7.184
TF6 Linkage TA05
Position 24.075
TF6 Linkage TB01
Position 28.682
Integrated consensus map Linkage B02
Position 70.828
Integrated consensus map Linkage A05
Position 50.382
Integrated consensus map Linkage B01
Position 52.695
SNP Position
Method
SSR Fragment size 264
Pattern* AG
Repeat count 10
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea