Peanut Marker Database

AHGS2712 Information

Marker name AHGS2712
Marker category Genome-SSR
Primer sequences Fw ATCAGTGCCATCATATCCCC
Rv TCAAGAGGCTACCATGCAAA
EST/Genome sequences SACT11C23
Lines
PIC Value
Lines
Map TF6 Linkage TA07
Position 6.817
TF6 Linkage TB07
Position 29.304
TF6 Linkage TA06
Position 56.055
Integrated consensus map Linkage A06
Position 57.622
Integrated consensus map Linkage A07
Position 40.588
Integrated consensus map Linkage B07
Position 85.749
SNP Position
Method
SSR Fragment size 202
Pattern* AG
Repeat count 10
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea