Peanut Marker Database

AHGS2710 Information

Marker name AHGS2710
Marker category Genome-SSR
Primer sequences Fw TTCTAAGCCATACCGCCAAC
Rv CCTCAGTTACCTGCGCATAA
EST/Genome sequences SACT10E21
Lines
PIC Value
Lines
Map AF5 Linkage AA10
Position 20.788
BF6 Linkage BB10
Position 18.339
Integrated consensus map Linkage B10
Position 58.512
Integrated consensus map Linkage A10
Position 95.57
SNP Position
Method
SSR Fragment size 283
Pattern* AG
Repeat count 10
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea