Peanut Marker Database

AHGS2709 Information

Marker name AHGS2709
Marker category Genome-SSR
Primer sequences Fw GTTGCTGGGTAAAGACCGAA
Rv GCAAATTGGCTCTATGTTTCC
EST/Genome sequences SACT09E20
Lines
PIC Value
Lines
Map AF5 Linkage AA04
Position 31.204
TF6 Linkage TA05
Position 17.26
TF6 Linkage TA07
Position 29.847
TF6 Linkage TA04
Position 57.215
Integrated consensus map Linkage A04
Position 52.531
Integrated consensus map Linkage A05
Position 41.244
Integrated consensus map Linkage A07
Position 66.375
SNP Position
Method
SSR Fragment size 268
Pattern* AG
Repeat count 10
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea